plcb plus. The PLCB issues, renews and validates retail and wholesale alcohol licenses in Pennsylvania. plcb plus

 
The PLCB issues, renews and validates retail and wholesale alcohol licenses in Pennsylvaniaplcb plus  NAME OF APPLICANT 12

As of right now, license renewals are still going to be processed as usual for 2021. 05/01/2023. 8 million in grants in fiscal year 2022-23 in support of Pennsylvania’s beer and wine industries and awarded nearly $1. Begin Main Content Area Approved Alcohol Server/Seller Training Providers. Also, on November 25, 2020, Governor Wolf signed House Bill No. Entry deadline 5:00 PM Friday. C. Annual Report. 03. PA. The PLCB also works to reduce and prevent dangerous and underage drinking through partnerships with schools, community groups, and licensees. Customer Services Web Content Text. If the license is to be “transferred” to the estate of the deceased, a “Correction To License form” (PLCB-959) must be executed by the administrator or executor of the estate. This report is updated the first of each month with the most recent reporting information. Act 39 of 2016 limits who may obtain this license to any person licensed by the PLCB, another state, or. We would like to show you a description here but the site won’t allow us. 56 billion over the past fiscal year, a decrease of $110. Laurenzano believes the Board has done something incorrectly, his argument needs to be taken to Court of Common Pleas. Bureau of Licensing ra-lblicensing@pa. According to the Centers for Disease Control and Prevention (CDC), a total of. residents only). Send it via email, link, or fax. We would like to show you a description here but the site won’t allow us. This was introduced to provide licensees with some additional relief during the pandemic, but also because the. ), while PLCB1, PLCB2, and PLCB3. The licensee is required to keep records of the appropriate training. Building upon Tokenworks’s classic military-grade durability and color-coded alerts, the IDVisor Smart is TokenWorks’ first Android-based Age Verification ID Scanner, adding a high-performance point-and-shoot style barcode scanner, an. RAMPCertified. ERP Resources for Wine & Spirits Suppliers. The internal openings below are ONLY for current and former Commonwealth employees. b. § 4-448(c)]. 31. e. While the PLCB is responsible for issuing and renewing liquor licenses, enforcement of liquor laws as they relate to licensees including bars and restaurants is not the responsibility of the agency. Construction of SLCC-5764-derived strains containing in-frame deletions in hly or hly plus plcB. Good Spirit stores, including 110Premium Collection stores, plus an e -commerce website and fulfillment center. ra-lblegal@pa. 02 billion (including liquor and. Pennsylvania residents and licensees will have until. Images were taken over 30 min and converted to pH and [Ca 2+] vac; each point represents one organelle. Electronic processes replace cumbersome paper license applications, renewals and validations. Europe PMC is an archive of life sciences journal literature. PLCs Plus International, Inc. The present study aimed to explore the association between PLCB1-4 and hepatocellular carcinoma (HCC). It is non-spore-forming and is not encapsulated. 8 million. PLCB engaged Oracle to provide a comprehensive, cloud-based enterprise resource. Signage – licensees are responsible for posting signs regarding responsible alcohol service. Begin Main Content Area Liquor Control Enforcement. Data from 212 patients with hepatitis B virus-associated. We would like to show you a description here but the site won’t allow us. m. For information and resources to facilitate doing business with the PLCB, please. 11th Restaurant License Auction Top Bidders November 2022 License Auction # License # County Municipality Highest Bidder Bid Amount 354 R‐9247 BERKS READING MALWA VENTURES LLC 129,000. The PLCB expects liquor vendors and their employees and agents to. psl psl psl psl psl psl psl psl psl psl psl psl psl psl psl psl pslThe PLCB4 gene provides instructions for making one form (the beta 4 isoform) of a protein called phospholipase C. Loading. This is an easy way to upload large amounts of items and quantities in a few clicks. There is a $2,000 application fee for this permit and an annual renewal fee of 2 percent of the cost of wine purchased from the PLCB for off-premises consumption. Killer Instinct, the 2013 reboot of the fighting game series, is going free-to-play. PLCB’s Bureau of Licensing. Wine Expanded Permit Basics. We will notify you of your effective date after we get this form from you. Tim Holden Member. 31, 2018 /PRNewswire/ -- The Pennsylvania Liquor Control Board (PLCB) today released its Fiscal Year 2017-18 Annual Report, which, for the first time, incorporates retail. Alcohol Education Programs engage many agencies, organizations, school districts and institutions of higher education in efforts to reduce underage and high-risk drinking. Winning bids range from $25,111 for a license in Benezette Township, Elk County to. If you have questions about your liquor license, application, renewal or similar topic, please contact [email protected]’re proud to sell and service products from the industry’s favorite automation equipment manufacturers. plcb plus license renewal. –11:00 p. m. The 4% increase will hit more than 3,500 products being sold, the. Entry deadline 5:00 PM Friday. The Pennsylvania Liquor Control Board had a rough day in court Wednesday. Taxes and store profits – totaling nearly $19. state. Combined sales may not exceed 50% of the AL’s own sales. ERP Resources for Licensees. Taxes and store profits – totaling nearly $19. Only the area where sales of alcohol will take place needs to be licensed under the permit. Recognition as a responsible licensee in your community. JUNETEENTH NATIONAL FREEDOM DAY – Wednesday, June 19, 2024. The Pennsylvania Liquor Control Board (PLCB) will be raising prices on various items across the state stores beginning January 15. NAME OF APPLICANT 12. 401 Northwest Office Building. Last 7 Days. E. Flanagan said he listened to the PLCB meeting via a telephone conference call and the vote to move the store was unanimous with all three board members — chairman Tim Holden, Mike Negra and Mary. Listeria can appear coccoid and motile depending upon the growth temperature. Consumers. PLCB > About > Contact > Liquor Control Enforcement. Sign it in a few clicks. lcb pa gov work with us. MANDATORY SITE VISIT LOCATIONS 1. Media. The PLCB, at its April 8, 2015 meeting, essentially approved moving the store to the Millbrook Plaza in Bald Eagle Township by agreeing to a new but tentative lease. This training covers the laws that Servers/Sellers must follow in Pennsylvania to. Published May. Related forms. 7 million in alcohol education grants. malt or brewed beverage manufacturers. [reserved]. Wine, Spirits & Accessories Suppliers. The PLCB has implemented NEW SYSTEMS transforming its business from a traditional retail model to a wholesale/distribution, e-commerce and retail-focused business. Closeout Only. Grey lines represent the ± 1 standard deviation (SD) from the mean for data obtained from hly-plcA-plcB- Lm vacuoles. 40 Pa. . A DBS license holder must do all of the following: Report to the PLCB the total malt or brewed beverages shipped in a calendar year. Proudly founded in 1681 as a place of tolerance and freedom. Killer Instinct is going free-to-play on Xbox and Steam. Login to your account: Email: *. ET. “I support memorializing this relief for bars and restaurants by making cocktails-to-go permanent,” Wolf said, though there was no word on whether Wolf. If you have any questions, please contact the Division of Tobacco Prevention and Control: 625 Forster Street. Vendor Code of Conduct: The PLCB is committed to maintaining the highest ethical standards in all of its operations. 1, 2023, 1:55 p. Classroom (in-person, instructor led) – In-person training dates are available at locations throughout Pennsylvania. SurgeryPlus Frequently Asked Questions General Questions . 01. Online (no instructor) – You may complete this training on your own in PLCB+. pa. gov or call the Licensing Information Center at 717-783-8250. gov so the PLCB can issue a refund. [47 P. Applications, forms and changes are continually updated at PLCB Bureau of Licensing Northwest Office Building Harrisburg, PA 17124-0001 Phone: 717. plus projected cost increases in the current year, related to. Limited wineries may sell their. Following citation by the BLCE, a licensee may either admit guilt and waive appeal rights by submitting a waiver accompanying the citation to the ALJ or request a hearing before an ALJ to challenge or contest the citation. (Six months ago, the PLCB raised. gov, fax to 717. HARRISBURG, Pa. 8h ago. Learn more. 233(c) (relating to minimum standards of classroom training), to the PLCB within 7 calendar days following each training session through the BAE's page on the PLCB's web site. The noted resource email account will be closely monitored by authorized PLCB personnel. 3. Download your modified document, export it to the cloud, print it from the editor, or share it with others using a. The plcB gene is cotranscribed with the actA gene, which encodes a bacterial surface protein required for actin-based motility within the host cell cytosol (12,. PLCB-2466 | Credit Card on File / ACH Program Authorization Form. The Pennsylvania Liquor Control Board (PLCB) will be raising prices on various items across the state stores beginning January 15. Public Service Pay Centre Pay Action Request 446-5E - Services. 11. Here's what you'll learn: At RAMPtraining. All rights reserved. PLCB Online Regulatory System ALC ED. additional fee of $10. stadium’s beer among those to see highest price increases. May 5, will feature 11 products from brands such as Caribou Crossing. Javascript must be enabled to use this site. RAMP. Send it via email, link, or fax. The comprehensive Responsible Alcohol Management Program (RAMP) offers training and. The following is offered as general guidance for how such festivals or events may be conducted lawfully under the Liquor Code and the PLCB’s Regulations. If you wish to pre-pay for this course for more than one person, please adjust the quantity in the cart to. Taxes and store profits – totaling nearly $19. Related forms. Join. The primer pair For_1kb_hly (XbaI) CC TCTAGA CGGGGAAGTCCATGATTAGTATGCC and. To submit a written request for an Advisory Opinion, email. The Pennsylvania Liquor Control Board said last. The necessary forms are available by calling the Board’s Licensing Information Center at (717) 783-8250, or by logging onto clicking on. ” A vendor’s permit fee of $265 and filing fee of $700 must be submitted with the application. the PLCB, whether via email, telephone or otherwise. 4 million in alcohol education grants. May 5, will feature 11 products from brands such as Caribou Crossing. . A Special Occasion Permit may only be granted for an event used by the applicant as a means of raising funds for itself. Get the Plcb special occasion permit completed. Fax: 717-214-6690. 74m) ceilings, hardwood floors and in-floor. the Pennsylvania Liquor Control Board is more than a collection of Fine Wine & Good Spirits stores. ($2. Plus, Pennsylvania's Dram Shop law means licensees and servers can both be held liable for death, injury, or damage caused by a minor who was unlawfully served alcohol. Additionally, the PLCB authorized about $2 million in grants in fiscal year 2020-21 in support of Pennsylvania’s beer and wine industries and awarded $1. Harrisburg – The Pennsylvania Liquor Control Board (PLCB), through its Limited-Release Lottery, will award lottery registrants the. Then, there’s the 18% liquor tax. ATTACHMENT #1 PROOF OF SITE VISIT must be signed by the party performing the site visit plus the PLCB official verifying the visit. Contact information for other areas of PLCB operations can be found in the Quick Reference Table in the appendix of this manual. Rising. 31 deadline for the 11th restaurant license auction authorized by Act 39 of 2016, the Pennsylvania Liquor Control Board (PLCB) has issued Notices of Selection to top bidders on 20 licenses. Plus, it comes with a $20 Audible credit. Health & Welfare Building. 2783 May Waive the 2021 Renewal Fee. Must have a current and valid health license from issuing authority. There is signage available from the PLCB; however the licensee may use other signage that is. $17. 109 Northwest Office Building. What is slo PLCB? These are listed in the Spirits Product Guide as "SLO" (Special Liquor Order) items, which may be ordered by calling the PLCB Special Purchases Section (800-332-7522, option 1) or stopping by. Form Popularity . 8820 | lcb. An Official Pennsylvania Government Website. Ordering Wine & Spirits. Lists of winning bids from each of the 12 previous auctions can be viewed through the links to the right. The PLCB’s Office of Wholesale Operations is committed to partnering with licensees to build collaborative relationships, develop innovative delivery and product offerings and effectively and efficiently coordinate the acquisition of wines and spirits to meet wholesale customers' needs. Sign Up Today and Save $5 on PLCB RAMP Server / Seller Training a Component of the RAMP Certification. 21 to Drink 18 to Party Nights - Follow Up. Join Our Team. The next open enrollment period will. The Bureau of Alcohol Education develops, promotes and uses various tools that have been proven effective in achieving. Phospholipase C carries out one particular step in the. Related links. The PLCB aims to ensure the responsible sale and consumption. Diaz again reiterated that this issue cannot be litigated at a Board meeting and that if Mr. Programs. 02 billion in sales and made $839. We would like to show you a description here but the site won’t allow us. Draw your signature, type it, upload its image, or use your mobile device as a signature pad. (link sends e-mail) or via my cell above. PLCB Employment Did you know. gov. Pennsylvania Liquor Control Board. The licensees who are required to file through PLCBplus are those who hold various types of licenses issued by the Pennsylvania Liquor Control Board, such. Please be advised that beginning October 1, 2021, per newly enacted Regulations, the first time an individual enrolls in Owner/ManagerBureau of Alcohol Education. The PLCB also works to reduce and prevent dangerous and underage drinking through partnerships with schools, community groups, and licensees. Get Trained Online. PENNSYLVANIA LIQUOR CONTROL BOARD PLUS ONLINE REGULATORY SYSTEM. Also, eligible entities may apply for an SOP by using the PLCB’s online regulatory. notice posting. Get the Plcb 2196 accomplished. Your session has expired. 01. The PLCB can refuse to renew a license, but it is not authorized to fine a licensee or revoke or suspend a. Type text, add images, blackout confidential details, add comments, highlights and more. m. Once the course appears click ‘Register’ and confirm your registration and begin the training. photographs and criminal history record information checks. Edit Plcb 2196. 18, 2021, 5:11 a. Information for new and existing wine and spirits vendors is available by selecting the. Please check FWGS. Harrisburg – The Pennsylvania Liquor Control Board (PLCB), through its Limited-Release Lottery, will award lottery registrants the opportunity to purchase 3,919 bottles of rare whiskeys. 3. Easily add and underline text, insert images, checkmarks, and signs, drop new fillable fields, and rearrange or delete pages from your document. 2. Information for new and existing wine and spirits vendors is available by selecting the “ERP Resources for Wine & Spirits Vendors” link. Make these selections in the Course Offering Search box: The PLCB Bureau of Alcohol Education makes available numerous resources to the public, elected officials, educators, community leaders, parents and others. Taxes and store profits – totaling nearly $17. Download your modified document, export it to the cloud, print it from the editor, or share it with others using a. A completed form will be required for each location below. m. 30, 2017 /PRNewswire-USNewswire/ -- Under new authority granted to the Pennsylvania Liquor Control Board (PLCB) by Act 44 of 2017, the PLCB today. PRA@fhiworks. PLCB-1350 02/08 COMMONWEALTH OF PENNSYLVANIA PENNSYLVANIA LIQUOR CONTROL BOARD BUREAU OF LICENSING APPLICATION FOR LICENSE MANUFACTURE, STORAGE OR TRANSPORTATION (SEE INSTRUCTIONS PAGE 2 OF 2 REVERSE) PAGE 1 OF 2 11. 5 billion since the agency's inception – are returned to Pennsylvania's General Fund, which finances Pennsylvania's schools, health and human. Revised 10/20/2021 1. Email: * Password: Forgot password? * Need an account? Register here ra-lblicensingmod@pa. Why was Senate Bill 3406 created?The PLCB also reserves the right to refuse to process orders for Special Order Products that are substantially similar to Products already available within the PLCB’s Retail Consumer Product Catalog and/or Wholesale Product Catalog or if the PLCB believes said products should be made available generally, in accordance with SectionRegan said the PLCB testified at a 2021 hearing that its 600 stores lack the shelf space or the refrigeration necessary to transport these products to liquor licensees. Selling alcohol to a minor is also a violation of the Pennsylvania Liquor Control Act, which can result in a fine of up to one thousand dollars ($1,000), imprisonment for up to one year, or both. card classic compact. Taxes and store profits – totaling nearly $18. PA Local (Weekly): A fresh look at the incredible people, places, and food of Pa. With respect to Amended Petition Count I (Mandamus), the Court granted summary relief in Petitioners’ favor and issued a writ of mandamus: (1) directing the PLCB to allow licensed vendors and licensed importers to ship SOs directly to customers; and (2). 5 billion since the agency's inception – are returned to Pennsylvania's General Fund, which finances Pennsylvania's schools, health and human. PLCB's regulations allow retail licensees to offer one free alcoholic drink per patron per offering, the Liquor Code allows a slot machine licensee to provide free drinks to any patron actively playing slots,4 and an amendment to the Gaming Act extended this privilege to patrons actively playing table games. RAMPCertified. 3. • Suppliers are responsible for payment of any costs associated with shipping or delivering SO items to PLCBMay 02, 2023 PLCB to hold online lottery for 3,919 bottles of rare whiskeys State residents have until Friday at 5 p. Types of Permits . Mr. Genomic View for PLCB3 Gene. 2. Harrisburg – The Pennsylvania Liquor Control Board (PLCB) is modernizing licensing operations with PLCB+, a new online platform through which licensing and permitting business can be conducted securely, quickly and simply over the Internet. 1 b. ) Sephora. Create this form in 5 minutes! Use professional pre-built templates to fill in and sign documents online faster. Log in to the RSOP. 2. Edit your plcb loop online. The PLCB also works to reduce and prevent dangerous and underage drinking through partnerships with schools, community groups, and licensees. The signature should be that of an owner or PLCB approved manager. Website. – must complete RAMP server/seller training. The Signature Wizard will allow you to add your. Free Blantons Gold. We would like to show you a description here but the site won’t allow us. 5 hours per week liquor store general manager pay schedule effective april 1, 2022 pay scale type ls class p. 29, 1933, at the end of Prohibition. Renewals/Validations. to 2:00 a. Licensees must enroll in and use the Licensee Online Order Portal (LOOP), a web-based application for licensees to place orders online, for wine and spirits pickup or delivery. 8250 Website: The information contained in this booklet has been prepared for the purpose of providing the Limited Winery01. 3. Below are links to resources for suppliers of wine, spirits and other items sold in FW&GS stores to facilitate business with the PLCB. 29, 1933, at the end of Prohibition. myPATH - Logged Off. 21 d. An applicant for a tavern gaming license must pay the Gaming Control Board an investigative fee of $1,000, plus any actual costs of a background investigation conducted by Gaming that exceeds the fee. 6) What prizes may be offered in regard to lawful events, tournaments, or contests on the licensed premises and are there limitations for the. Annual Reports. Begin Main Content Area Board Members Chairman. While the online training program is under review by the PLCB, the applicant may not advertise the availability of the online training program or provide public access to the online training program. 82150 1 Plus 1 Equals 3 Brut Rose Cava Seleccio Nonvintage 750 ML. Harrisburg – The Pennsylvania Liquor Control Board (PLCB), through its Limited-Release Lottery, will award lottery registrants the opportunity to purchase 814 bottles of rare whiskeys. Finally, RAMP training can help you prevent drunk driving. Keystone State. 8, 2016, who serves or sells alcoholic beverages and/or checks IDs – including bartenders, waiters, beer distributor sales persons, bouncers, doorpersons, etc. | 3 Act 39 of 2016 – The Popular Highlights • Eliminated restrictions on Sunday hours and the number of Fine Wine & Good Spirits stores that may be open on Sundays. The advanced tools of the editor will direct you through the editable PDF template. — In addition to offering a limited number of items for curbside pickup at select store locations across the state on Monday, the Pennsylvania Liquor Control Board also announced. additional fee of $10. 4 million or 13. POPULAR ON LCB. The PLCB removes products from its portfolio that do not meet sales expectations or enhance overall product selection. m. Ordering Wine & Spirits. 47 per unit (regardless of unit size or category) as of July 3, 2023. Thanksgiving Day: Closed. Pennsylvania Liquor Control Board. Last 24 Hours. 7, 2020, 6:26 p. People also ask. Seventeen states (including Pennsylvania) and jurisdictions in Alaska, Maryland, Minnesota, and. 3. GasBuddyPLCB Bureau of Alcohol Education makes available numerous resources to the public, elected officials, educators, community leaders, parents and others. They oversee the operation of retail liquor stores, enforce liquor laws and regulations, and issue licenses to establishments that sell alcohol. ©2021 SurePoint. LOOP will be unavailable between June 30 and July 2, and effective July 3, when the new LOOP debuts, stores and LSCs will no longer be able to accept orders by phone, fax or other means. HARRISBURG, Pa. Learn more. The PLCB also said that it will require licensees to file all documents and pay all fees necessary to bring their license up to date for 2020 by Dec. 3 million workers who are a part of the International United Food & Commercial Workers, and 35,000 proud members of Local 1776 Keystone State! It’s my pleasure to welcome you to join the UFCW Local. License fees that will continue to be collected in 2021 include those associated with wine expanded permit applications and renewals, direct wine shipper licenses, change of ownership and/or. Effortlessly add and underline text, insert pictures, checkmarks, and symbols, drop new fillable areas, and rearrange or remove pages from your paperwork. The following is offered as general guidance for how such festivals or events may be conducted lawfully under the Liquor Code and the PLCB’s Regulations. Learn how to obtain a license through the issuing of a new license, a person-to-person transfer, a place-to-place transfer or a double transfer. 7522 (option 5) or email plcbloop@pa. 00 out of 5 based on 8 customer ratings. Edit your plcb 1842 online. Requires 400 square feet of serving space. org . Submitting the plcb special occasion permit with signNow will give better confidence that the output template will be legally binding and safeguarded. The Retail Liquor License Quota. 02, 2022, 5:01 a. 1 billion in sales for the fiscal year ended June 30, 2019, only 9% remained after expenses for transfer to the commonwealth general fund. Plus, it comes with a $20 Audible credit. In Philadelphia, where that is 8%, the same bottle now costs an additional $1. Please enter your RAMPCertified. Press Releases; Search Licensees; PLCB to process. Please be advised that it is the Pennsylvania State Police, Bureau of Liquor Control Enforcement (“Bureau. I do not see a Manage LID button on my dashboard, why? If you don’t see the Manage LID button on your dashboard this means you are not a registeredPetitioners also argue that they are entitled to costs and damages under Section 8303 of the Judicial Code, plus associated interest and attorneys’ fees. Office of Chief Counsel. PLCB > Education > RAMP > Server/Seller Classroom Instructors. Follow these instructions to register for a RAMP Owner/Manager training. Either the producer or their broker may apply to become the “Vendor of Record. 8h ago. More:Furthermore, the PLCB-approved manager must renew Owner/Manager Training every two years. Wine Expanded Permit Basics. Images were taken over 30 min and converted to pH and [Ca 2+] vac; each point represents one organelle. With 3,919 bottles of rare whiskeys to sell and 585 Fine Wine & Good Spirits retail stores, the Pennsylvania Liquor Control Board has started online registration for a limited-release sales lottery. Need an account? Register here. gov. plus projected cost increases in the current year, related. If you do not have this experience, please visit the Commonwealth of PA Job Opportunities page for a complete listing of employment. 17, to opt in to one or more of the lotteries and/or. 3 years ago. Tutorial videos help walk licensees through the process. PLCB warns against using online liquor. The PA Liquor Control Board is set to raise prices on 3,500 products by 4%. PLCB Employment. The PLCB regulates the distribution of beverage alcohol in Pennsylvania, operates more than 600 wine and spirits stores statewide and licenses more than 20,000 beverage alcohol producers. As the commonwealth’s wholesale distributor of wines and spirits to retail licensees and Fine Wine & Good Spirits stores , the PLCB manages warehousing and transportation of productsResponsible Alcohol Management Program (RAMP) Please direct all inquiries to the RAMP toll free number at 866-275-8237 or email ra-lbramp@pa. Seventeen states (including Pennsylvania) and jurisdictions in Alaska, Maryland, Minnesota, and South Dakota control the sale of distilled spirits and, in some cases, wine and beer through government agencies at the wholesale level. PerformCare, originally known as Community Behavioral HealthCare Network of Pennsylvania, was founded in 1994 and serves as a compassionate link to care for our members and a creative collaborator in solutions for our partners. Below are links to resources for suppliers of wine, spirits and other items sold in FW&GS stores to facilitate business with the PLCB. Professionally drafted and regularly updated online templates. PLCBplus stands for Pennsylvania Liquor Control Board (PLCB) Plus, which is an electronic system used by certain licensees in Pennsylvania to file their required reports and payables online. Pennsylvania Liquor Control Board is responsible for regulatory control of alcohol in Pennsylvania, serves as the wholesaler of wine and spirits to 15,000+ retail licensees, and operates 585 Fine Wine & Good Spirits stores and an ecommerce website. licensed distilleries of historical significance. gov LCB-690 02/20 . The PLCB also summarizes citations and adjudications against licensees within its License Search System. New PLCB+ users must complete a registration process prior to filing for the new license. You will be automatically redirected to the home page, or you may click below to return immediately. Begin Main Content Area Search Contact Us. 72 i. Quotas are updated every 10 years following the federal decennial. To submit a written request for an Advisory Opinion, email. Related forms. ” READ MORE : Pa. This publication outlines the PLCB’s operations, popular products and sales trends and . This was introduced to provide licensees with some additional relief during the pandemic, but also because the legislature.